View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4776_high_4 (Length: 223)
Name: NF4776_high_4
Description: NF4776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4776_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 39824780 - 39824590
Alignment:
| Q |
16 |
ttaactacctttggtgacacaaactgcatggaacagttacttgttcattgcgcaaacgcaatcgaaacaaacgatgtaacacttgctcaacaaatccttt |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39824780 |
ttaactacctttggagacacaaactgcatggaacagttacttgttcattgcgcaaacgcaatcgaaacaaacgatgtaacacttgctcagcaaatccttt |
39824681 |
T |
 |
| Q |
116 |
gggttctcaataacatagcaccacaagacggtgattcaaatcaacgcttagcttatagtttccttagagccctcacaaatcgtgcagtgaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824680 |
gggttctcaataacatagcaccacaagacggtgattcaaatcaacgcttagcttatagtttccttagagccctcacaaatcgtgcagtgaa |
39824590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University