View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4776_low_6 (Length: 214)
Name: NF4776_low_6
Description: NF4776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4776_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 1695099 - 1695214
Alignment:
| Q |
18 |
atcagaacaatgatagcnnnnnnngcagcctctatgagaagataaagcagcagcttcttctgaaattagacaaaaatagcataatatgaatggttaacat |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
1695099 |
atcagaacaatgatagcaaaaaaagcagcctctatgagaagataaagcagcagcttcttctgaaattagacaaaaatagcataataagaatggtttacat |
1695198 |
T |
|
| Q |
118 |
taataattaggtaatc |
133 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1695199 |
taataattaggtaatc |
1695214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 196
Target Start/End: Original strand, 1695248 - 1695277
Alignment:
| Q |
167 |
gcttatagtgtgaaagcatacgtacccttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1695248 |
gcttatagtgtgaaagcatacgtacccttc |
1695277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 85
Target Start/End: Original strand, 1700231 - 1700272
Alignment:
| Q |
44 |
agcctctatgagaagataaagcagcagcttcttctgaaatta |
85 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
1700231 |
agcctcgatgagaagataaagcagcaactttttctgaaatta |
1700272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University