View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4777-Insertion-12 (Length: 156)

Name: NF4777-Insertion-12
Description: NF4777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4777-Insertion-12
NF4777-Insertion-12
[»] chr1 (1 HSPs)
chr1 (7-156)||(17192272-17192421)
[»] chr5 (1 HSPs)
chr5 (9-156)||(28800098-28800248)
[»] chr8 (1 HSPs)
chr8 (9-156)||(4281806-4281956)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 7 - 156
Target Start/End: Original strand, 17192272 - 17192421
Alignment:
7 aagtcttgcctctttgtggtggaaagatttgacaatgttagaggataggagtgggttgagttggttcaaatcggaggtggttagaaagatgagagaaagt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17192272 aagtcttgcctctttgtggtggaaagatttgacaatgttagaggataggagtgggttgagttggttcaaatcggaggtggttagaaagatgagagaaagt 17192371  T
107 atgagtactttttggaaggatagatggagatccgatatccccttttgtga 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
17192372 atgagtactttttggaaggatagatggagatccgatatccccttttgtga 17192421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 28800098 - 28800248
Alignment:
9 gtcttgcctctttgtggtggaaagatttgacaatgttagaggataggagtgggttgagttggttcaaatcggaggtggttagaaagatgagagaaagtat 108  Q
    |||||||||| |||||||||||||||||||||| ||| || |||||||| ||||||| |||||| ||||| ||||||||||||| |||||||||  | ||    
28800098 gtcttgcctcgttgtggtggaaagatttgacaacgttggaagataggagcgggttgacttggtttaaatcagaggtggttagaaggatgagagacggaat 28800197  T
109 gagtact---ttttggaaggatagatggagatccgatatccccttttgtga 156  Q
    |||||||   |||||||||||||| ||||||||| ||||||||||||||||    
28800198 gagtactagcttttggaaggataggtggagatccaatatccccttttgtga 28800248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 7e-29; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 7e-29
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 4281806 - 4281956
Alignment:
9 gtcttgcctctttgtggtggaaagatttgacaatgttagaggataggagtgggttgagttggttcaaatcggaggtggttagaaagatgagagaaagtat 108  Q
    ||||||||||||||||||||||||||||||||| ||| ||||| || ||||||  || ||||||| | |||||||||||||||| |||| ||||  | ||    
4281806 gtcttgcctctttgtggtggaaagatttgacaacgttggaggagagaagtgggccgacttggttctactcggaggtggttagaaggatgggagatggaat 4281905  T
109 gag---tactttttggaaggatagatggagatccgatatccccttttgtga 156  Q
    |||   || ||||||||| ||||||||||||||| ||| ||||||||||||    
4281906 gagcactagtttttggaatgatagatggagatcctatacccccttttgtga 4281956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University