View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4777-Insertion-14 (Length: 191)
Name: NF4777-Insertion-14
Description: NF4777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4777-Insertion-14 |
 | |
|
| [»] scaffold0366 (1 HSPs) |
| |
|
| [»] scaffold0459 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0366 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 7670 - 7853
Alignment:
| Q |
8 |
ggctcaaaacctcaaattatcaccaagagttttcttgacaaacctgttccatataaccatgaccttgctcttctgcttttcaaagaagtatagagaaggc |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7670 |
ggctcaaagcctcaaattatcaccaagagttttcttgacaaacctgttccatataaccatgaccttgctcttctgcttttcaaagaagtatagagaaggc |
7769 |
T |
|
| Q |
108 |
aaaaagtgaatataattcctagcaatccatttgcatacaaccaatgaaattggtatttatccaatgttggatccccctctttag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7770 |
aaaaagtgaatataattcctagcaatccatttgcatacaaccaatgaaattggtatttatccaatgttggatccccctctttag |
7853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 7674 - 7857
Alignment:
| Q |
8 |
ggctcaaaacctcaaattatcaccaagagttttcttgacaaacctgttccatataaccatgaccttgctcttctgcttttcaaagaagtatagagaaggc |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7674 |
ggctcaaagcctcaaattatcaccaagagttttcttgacaaacctgttccatataaccatgaccttgcttttctgcttttcaaagaagtatagagaaggc |
7773 |
T |
|
| Q |
108 |
aaaaagtgaatataattcctagcaatccatttgcatacaaccaatgaaattggtatttatccaatgttggatccccctctttag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7774 |
aaaaagtgaatataattcctagcaatccatttgcatacaaccaatgaaattggtatttatccaatgttggatccccctctttag |
7857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University