View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4777_high_15 (Length: 230)
Name: NF4777_high_15
Description: NF4777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4777_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 3499326 - 3499535
Alignment:
| Q |
13 |
caatgccctgacatcatggtcgaaacctacaaaaaccnnnnnnnnngttatctttctannnnnnnccctagaaaacctatctctctaaacttttagagaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3499326 |
caatgccctgacatcatggtcgaaacctacaaaaacctttttttttgttatctttctatttttttccctagaaaacctatctctctaaacttttagagaa |
3499425 |
T |
|
| Q |
113 |
ttt-atttatcgatagaaaacnnnnnnngagagatctgtttaagnnnnnnnatcagataattgtttgtgtttcttccctatgcagacaaataaaaatgca |
211 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3499426 |
ttttatttatcgatagaaaactttttttgagagatctgtttaagtttttttatcagataattgtttgtgtttcttccctatgcagacaaataaaaatgca |
3499525 |
T |
|
| Q |
212 |
cacacaaaat |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
3499526 |
cacacaaaat |
3499535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University