View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4777_low_10 (Length: 267)
Name: NF4777_low_10
Description: NF4777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4777_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 51 - 213
Target Start/End: Complemental strand, 17530326 - 17530164
Alignment:
| Q |
51 |
tcattcactcgaagagattcatgaattcactccacgtgtcagtgctctctgtcttaatgttggaacactctcatcttcttctcttccttctatgatagct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17530326 |
tcattcactcgaagagattcatgaattcactccacgtgtcagtgctctctgtcttaatgttggaacactctcatcttcttctcttcctgctatgatagct |
17530227 |
T |
 |
| Q |
151 |
gctgctaatctatgctctcagttgaatatcccttgggttcttgatcctgttgctgtctctgct |
213 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17530226 |
gctgctaagctatgctctcagttggatatcccttgggttcttgatcctgttgctgtctctgct |
17530164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 51 - 213
Target Start/End: Original strand, 17656210 - 17656372
Alignment:
| Q |
51 |
tcattcactcgaagagat-tcatgaattcactccacgtgtcagtgctctctgtcttaatgttggaacactctcatcttcttctcttccttctatgatagc |
149 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17656210 |
tcattcactcgaagagatatca-gaattcactccacgagtaagtgctctctgtcttaatgttggaacactctcatcttcttctcttcctgctatgatagc |
17656308 |
T |
 |
| Q |
150 |
tgctgctaatctatgctctcagttgaatatcccttgggttcttgatcctgttgctgtctctgct |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17656309 |
tgctgctaagctatgctctcagttgaatatcccttgggttcttgatcctgttgctgtctctgct |
17656372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University