View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4777_low_13 (Length: 238)
Name: NF4777_low_13
Description: NF4777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4777_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 6368408 - 6368614
Alignment:
| Q |
13 |
caaagggtatgtatgtattaaatattttgcatcgtgttgcttcgtattagtatatgagtaaattgtcattttggtccgtaaatgtgtgacgtggt-ctat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
6368408 |
caaagggtatgtatgtattaaatattttgcatagtgttgcttcgtattagtatatgagtaaattgtcattttggtccgtaaatgtgtgaggtggtgctat |
6368507 |
T |
|
| Q |
112 |
tatagtctctaaatgtatcgaaactttgaaaatatctatggatgtgtcttctgctagtaattttaataagcaccaaatagagaaacggaacacatgtttg |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
6368508 |
tatagtctctaaatgtatctaaactttgaaaatatctatggatgtgtcttctgctagtaattt---taagcaccaaacgaagaaactgaacacatgtttg |
6368604 |
T |
|
| Q |
212 |
acgacaaaat |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
6368605 |
acgacaaaat |
6368614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University