View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4777_low_7 (Length: 350)
Name: NF4777_low_7
Description: NF4777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4777_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 13 - 155
Target Start/End: Complemental strand, 38942004 - 38941859
Alignment:
| Q |
13 |
catcatttgcaaaacaggtctgtgttaagt---acatggacatgcacttgttttataacaaaataaaatgttaataaatagaatcaagtgaagtgaatgc |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38942004 |
catcatttgcaaaacagatctgtgttaagacagacatggacatgcacttgttttataacaaaataaaatgttaataaatagaatcaagtgaagtgaatgc |
38941905 |
T |
 |
| Q |
110 |
ttgagttacaatttattcaatattataacaagagtttcagttccaa |
155 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38941904 |
ttgagttacaatttatttaatattataacaagagtttcagttccaa |
38941859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University