View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778-Insertion-13 (Length: 278)
Name: NF4778-Insertion-13
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778-Insertion-13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 70 - 278
Target Start/End: Original strand, 2299044 - 2299252
Alignment:
| Q |
70 |
agtttgcccatactaaggtttttcgttcctgtttgcaggtcacatttgccacactatattgtcagtttttaatccatttacatgtcagaagttttgttgt |
169 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2299044 |
agttcgcccatactaaggtttttcgttcatgtttgcaggtcacatttgccacactatattgtcagttttccatccatttacatgtcagaagttttgttgt |
2299143 |
T |
|
| Q |
170 |
aatgggtctagcaatctttaattataggagtcttctaaggttgtgaagacgtaccatagaccttttggttaatgctgttactatcccttattataaaagc |
269 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
2299144 |
aatgggtctagcaatctttaactataggagtcttccaaggttgtgaagacgtaccatagacctttcggttaatgttgctactatcccttattataaaagc |
2299243 |
T |
|
| Q |
270 |
taaaattca |
278 |
Q |
| |
|
||||||||| |
|
|
| T |
2299244 |
taaaattca |
2299252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 2298931 - 2298998
Alignment:
| Q |
8 |
tcactatcccattttaaacactactttgtgtggttcatatgatgaatgagtttgatcgtaggagtttg |
75 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
2298931 |
tcactatctcatttataacactactttgtgtggttcatatgatgaatgagtttaattgtaggagtttg |
2298998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University