View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778-Insertion-18 (Length: 57)
Name: NF4778-Insertion-18
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778-Insertion-18 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 36428717 - 36428767
Alignment:
| Q |
7 |
attttgaatcttttaccttttggtgtagtgaaaccatcacttgaacaaata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36428717 |
attttgaatcttttaccttttggtgtagtgaaaccatcactcgaacaaata |
36428767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 36308395 - 36308445
Alignment:
| Q |
7 |
attttgaatcttttaccttttggtgtagtgaaaccatcacttgaacaaata |
57 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
36308395 |
attttgaatcttctaccctttggtgtaatgaagccatcacttgaacaaata |
36308445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University