View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4778-Insertion-18 (Length: 57)

Name: NF4778-Insertion-18
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4778-Insertion-18
NF4778-Insertion-18
[»] chr7 (2 HSPs)
chr7 (7-57)||(36428717-36428767)
chr7 (7-57)||(36308395-36308445)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-18; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 36428717 - 36428767
Alignment:
7 attttgaatcttttaccttttggtgtagtgaaaccatcacttgaacaaata 57  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||    
36428717 attttgaatcttttaccttttggtgtagtgaaaccatcactcgaacaaata 36428767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 36308395 - 36308445
Alignment:
7 attttgaatcttttaccttttggtgtagtgaaaccatcacttgaacaaata 57  Q
    |||||||||||| |||| ||||||||| |||| ||||||||||||||||||    
36308395 attttgaatcttctaccctttggtgtaatgaagccatcacttgaacaaata 36308445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University