View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778-Insertion-9 (Length: 267)
Name: NF4778-Insertion-9
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778-Insertion-9 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 184 - 267
Target Start/End: Complemental strand, 32727819 - 32727736
Alignment:
| Q |
184 |
ggaaagactgtcatgttcacagcaccacgagtctagcaggaaaaatacgatagattaagtaagtaaagtactctcatctcatga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32727819 |
ggaaagactgtcatgttcacagcaccacgagtctagcaggaaaaatacgatagattaagtaagtaaagtactctcatctcatga |
32727736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 84
Target Start/End: Complemental strand, 32727997 - 32727919
Alignment:
| Q |
10 |
taaagcacattctgagtcccaatgtgtttttgtagtttaagagaaagggaaata----tataattactgtatcttctgg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32727997 |
taaagcacattctgagtcccaatgtgtttttgtagtttaagagaaagggaaatatatatataattactgtatcttctgg |
32727919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University