View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_high_16 (Length: 385)
Name: NF4778_high_16
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 7 - 377
Target Start/End: Complemental strand, 44634278 - 44633918
Alignment:
| Q |
7 |
gttcattccaaatgcatcagaggctgttcttttttcagtaatttttacattgattgctttgcttatctttggctttgtcaagggatgcttcaccggcagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44634278 |
gttcattccaaatgcatcagaggctgttcttttttcagtaatttttacattgattgctttgcttatctttggctttgtcaagggatgcttcaccggcagc |
44634179 |
T |
 |
| Q |
107 |
aaacctatcaaaagtgctttcgaaactgctctcatcggcgccattgcatccgcagctgcttttggtttggcaaaggctttcaatccatagtttcacgttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44634178 |
aaacctatcaaaagtgctttcgaaactgctctcatcggcgccattgcatccgcagctgcttttggtttggcaaaggctttcaatccatagtttcacgttt |
44634079 |
T |
 |
| Q |
207 |
tgtatttaatggcaacgaaggcaagctatttcagaactatttacttgtggtcgcaacgattttcattctcttgccacattgttatgagcaactacattta |
306 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44634078 |
tgtatttaatggcaacgaaggcaaactat----------attacttgtggtcgcaacgattttcattctcttgccacattgttatgagcaactacattta |
44633989 |
T |
 |
| Q |
307 |
tctatttacagtttacttgttggtgtttaattttttaaataaaaagtattaattagatgctacttcttctc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44633988 |
tctatttacagtttacttgttggtgtttaattttttaaataaaaagtattaattagatgctacttcttctc |
44633918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 7 - 201
Target Start/End: Complemental strand, 44622799 - 44622605
Alignment:
| Q |
7 |
gttcattccaaatgcatcagaggctgttcttttttcagtaatttttacattgattgctttgcttatctttggctttgtcaagggatgcttcaccggcagc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
44622799 |
gttcattcgaaatgcatcagaggctgttcttgtttcagtggtggttacattgattgctttgcttatctttggctttgtcaagggatccttcaccggcaac |
44622700 |
T |
 |
| Q |
107 |
aaacctatcaaaagtgctttcgaaactgctctcatcggcgccattgcatccgcagctgcttttggtttggcaaaggctttcaatccatagtttca |
201 |
Q |
| |
|
|| || |||| |||||||| ||||||||||| || || |||||||| || || ||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
44622699 |
aagccaatcaggagtgctttggaaactgctctaattggtgccattgcctctgcggctgcttatggtttggcaaaggctttccatccatagtttca |
44622605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University