View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_high_21 (Length: 327)
Name: NF4778_high_21
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 18 - 312
Target Start/End: Original strand, 37460013 - 37460307
Alignment:
| Q |
18 |
atatttcttcttcttttgaataattttcttgtttcaattatttattacttcaaacatcttggttttcttatatggaagatacaatcagaaaaaattggac |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37460013 |
atatttcttcttcttttgaatcattttcttgtttcaattatttattacttcaaacatcttggttttcttatatggaagatacaatcagaaaaaattggac |
37460112 |
T |
 |
| Q |
118 |
ataatgaggtaagttactcacaggtctattttttattattctgtttgatcctaagaatttttgcatatgctatatcaattcctttaagttaatatttgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37460113 |
ataatgaggtaagttactcacaggtctattttttattattctgtttgatcctaagaatttttgcatatgctatatcaattcctttaagtaaatatttgct |
37460212 |
T |
 |
| Q |
218 |
tctttatggttgcagttatagtaagagaaaaccaaatgaaagtatgaggcttattgtgatatttttctttggaggatttcttggcttatttatag |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37460213 |
tctttatggttgcagttatagtaagagaaaaccaaatgaaagtatgaggcttattgtgatatttttctttggaggatttcttggcttatttatag |
37460307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University