View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_high_43 (Length: 228)
Name: NF4778_high_43
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 19079115 - 19079208
Alignment:
| Q |
119 |
ggatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcaaaatttcgtagaagacgttaacttatatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19079115 |
ggatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcaaaatttcgtagaagacgttaacttatatt |
19079208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 19077390 - 19077483
Alignment:
| Q |
119 |
ggatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcaaaatttcgtagaagacgttaacttatatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19077390 |
ggatatcctatgccaagattattatggaatcattggagagattatcatgggagattgattgatcagaatttcgtagaagacgttaacttatatt |
19077483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 37 - 85
Target Start/End: Original strand, 19077308 - 19077356
Alignment:
| Q |
37 |
atatccaatgagtttaggcgtagaagctgcaattgattaacctaaggtg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19077308 |
atatccaatgagtttaggcgtagaagctgcaattgattaacctaaggtg |
19077356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University