View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_high_44 (Length: 227)
Name: NF4778_high_44
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_high_44 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 29314536 - 29314315
Alignment:
| Q |
7 |
aaatcaagtatttactatgaaattaatcacattcctaaagnnnnnnnn-acttgattaaaaacaactcatcgaatatgataatgttgtagggtgataggt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29314536 |
aaatcaagtatttactatgaaattaatcacattcctaaagtttttttttacttgattaaaaacaactgatcgaatatgataatgttgtagggtgataggt |
29314437 |
T |
 |
| Q |
106 |
gcatttatcatttgtttgggcttgtaccttgttgtgtggggcaaaagcaaaaattacaacaatccatcaaatgcaattagtgacgagcatgttttgccgg |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29314436 |
gcatttatcatttgtttgggtttgtaccttgttgtgtggggcaaaagcaaagattacaacaatccatcaaatgcaattagtgaagagcatgttttgccgg |
29314337 |
T |
 |
| Q |
206 |
ctaagcaaaatgtaggtgaaaa |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29314336 |
ctaagcaaaatgtaggtgaaaa |
29314315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University