View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_high_47 (Length: 214)
Name: NF4778_high_47
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 37643348 - 37643170
Alignment:
| Q |
18 |
aagaaatgaggtgatctgacttgactacatgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643348 |
aagaaatgaggtgatctgacttgactacatgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagct |
37643249 |
T |
 |
| Q |
118 |
atagtcctacgccacttaaaataaaaattgataagagttttatatgtgaaagctgtcagctaggaaacaggtctggtat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643248 |
atagtcctacgccacttaaaataaaaattgataagagttttatatgtgaaagctgtcagctaggaaacaggtctggtat |
37643170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 119
Target Start/End: Complemental strand, 44171243 - 44171171
Alignment:
| Q |
47 |
tgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagctat |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||| ||| |||| || |||| || |||||| |||||||||| |
|
|
| T |
44171243 |
tgttcttcgagtttgagttgcgaagaatatgtaacggctggtccgtgtgatttagtatgcaagtggaagctat |
44171171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 119
Target Start/End: Complemental strand, 44191539 - 44191467
Alignment:
| Q |
47 |
tgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagctat |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||| ||| |||| || |||| || |||||| |||||||||| |
|
|
| T |
44191539 |
tgttcttcgagtttgagttgcgaagaatatgtaacggctggtccgtgtgatttagtatgcaagtggaagctat |
44191467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University