View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_11 (Length: 410)
Name: NF4778_low_11
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 8 - 392
Target Start/End: Original strand, 53218511 - 53218895
Alignment:
| Q |
8 |
tgagatgaatcggaaggaaaaacatgagtgaaaccaccgtatgtttccaattttactctcttcgcatcttgcaaatcggaaggaactgataacgtcactg |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53218511 |
tgagatgaattggaaggaaaaacatgagtgaaaccaccgtatgtttccaattttactctcttcgcatcttgcaaatcggaaggaactattaacgtcactg |
53218610 |
T |
 |
| Q |
108 |
attccgaatcgttaatggatatacatgaggaagatgagctcttcttcttcgaattgttagtcgctatgatgttttttgtttgagtttttggccacgcagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53218611 |
attccgaatcgttaatggatatacatgaggaagatgagctcttcttcttcgaattgttagtcgctatgatgttttttgtttgagttttcggccacgcagt |
53218710 |
T |
 |
| Q |
208 |
tttggttcttacacgcggagcttgatttgggggttgaacttgagagggacgaattctgagaaatactttgagattctcgttttctgatggatttttcaga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53218711 |
tttggttcttacacgcggagcttgatttgggggttgaacttgagagggacgaattctgagaaatactttgagattctcgttttctgatggatttttcaga |
53218810 |
T |
 |
| Q |
308 |
ttctcgtttttctctgatgtggttgatggaatttgtgatggttggtgacataacatttcttcgttaggaaatggtgtgattaacg |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53218811 |
ttctcgtttttctctgatgtggttgatggaatttgtgatggttggtgagataacatttcttcgttaggaaatggtgtgattaacg |
53218895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University