View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_17 (Length: 380)
Name: NF4778_low_17
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_17 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 251 - 380
Target Start/End: Complemental strand, 31821519 - 31821389
Alignment:
| Q |
251 |
tgcaagaagtctgtt-gactaatttaaacaccaaaagacaaaaacatgaaagattacagccattcacttttagaagcatctaagtttggcaactaaagct |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31821519 |
tgcaagaagtctgtttgactaatttaaacaccaaaagacaaaaacatgaaagattacaaccgttcacttttagaagcatctaagtttggccactaaagct |
31821420 |
T |
 |
| Q |
350 |
ttctaactagtctttttgggaagaaatataa |
380 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
31821419 |
ttctaactagtcttttcgggaagaaatataa |
31821389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 70
Target Start/End: Complemental strand, 31821570 - 31821520
Alignment:
| Q |
20 |
tgatccgacgagtatcaagatttaaaccaattaaatttaatcattataaaa |
70 |
Q |
| |
|
|||||||| |||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31821570 |
tgatccgatgagtatgaagatataaaccaattaaatttaatcattataaaa |
31821520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University