View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_2 (Length: 553)
Name: NF4778_low_2
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 270 - 505
Target Start/End: Original strand, 16162476 - 16162712
Alignment:
| Q |
270 |
tgcagtgtatgttagattatgacatgtttcttttatctttttaatttgtagttgctgatgtctcagttatcttttatgtcttcctctgtgtgtgtgttgt |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16162476 |
tgcagtgtatgttagattatgacatgtttcttttatctttttaatttgtggttgctgatgtctcagttatcttttatgtcttcccctgtgtgtgtgttgt |
16162575 |
T |
|
| Q |
370 |
agctgattcaagttgacgtattacttggtgtggtttttgtctgctaccttatgcttggtgttatgattatttgattttaaattgatgtttgccttgaaac |
469 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16162576 |
agctgattcaagttgacttgttaattggtgtggtttttgtctcctaccttgtgcttggtgttgtgattatttgattttaaattgatgttttccttgaaac |
16162675 |
T |
|
| Q |
470 |
atttgt-accttgctttaaatttatcttgattttgaa |
505 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
16162676 |
atttgtaaccctgctttaaatttatcttgattttgaa |
16162712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 16162224 - 16162428
Alignment:
| Q |
20 |
gatggcacatccttggtatgtagtttgtttttcctttcctttgggttcttgatgggtcgattttgtatcct-gggtttcgtttgatttgataaattaatg |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16162224 |
gatggcacatccttggtttgtagtttgtttttcctttcctttgggttcttgatgggtcgattttgtatcctggggtttcgtttgatttgataaattaatg |
16162323 |
T |
|
| Q |
119 |
tg-nnnnnnncaatccctgtggtatttctcatgggtgatgttgcatgctatgattttggatgggtggcgtgtttgattatttttattgcaagttcatata |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
16162324 |
tgttttttttcaatccctgtggtatttctcatgggcgatgttgcatgctatgattttggatgggtggcgtgtttgattattcttattgcaggttcatata |
16162423 |
T |
|
| Q |
218 |
gattc |
222 |
Q |
| |
|
||||| |
|
|
| T |
16162424 |
gattc |
16162428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University