View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_27 (Length: 279)
Name: NF4778_low_27
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 3 - 144
Target Start/End: Complemental strand, 41659871 - 41659731
Alignment:
| Q |
3 |
gaatgtattttctgatggcacaaatttattgggagatatgtttctatcgaannnnnnnnccatcaaaagctatcttctaatcggcctttttcctaaaaaa |
102 |
Q |
| |
|
|||||||| |||||||| || | |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41659871 |
gaatgtatcttctgatgacaaatatttattgggagatatgtttctatcgaattttttt-ccatcaaaagctatcttctaatcggactttttcctaaaaaa |
41659773 |
T |
 |
| Q |
103 |
tttaagcaaaatttcttaagatgattaaattacaaagactat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41659772 |
tttaagcaaaatttcttaagatgattaaattataaagactat |
41659731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University