View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_31 (Length: 265)
Name: NF4778_low_31
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 25 - 256
Target Start/End: Original strand, 9679917 - 9680148
Alignment:
| Q |
25 |
ccgatcattatcaacgatcaagatgattgactacattgatggctggctgcataaaagtaataaatattcatagtaattttcttaatacctttcccatgtt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9679917 |
ccgatcattatcaacgatcaagatgattgactacattgatggctggctgcataaaagtaataataattcatagtaattttcttaatacctttcccatgtt |
9680016 |
T |
 |
| Q |
125 |
ggataacaaaggtaggttataaccactgatttttgcaacaaagttctggtccaataaaacatcagtaattttgatattgtttgaatatacaccaggaaca |
224 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
9680017 |
ggataacaaaggcatgttataaccactgattttcgcaacaaagttttggtccaataaaacatctgtgattttgatattgtttgaatatacaccaggaaca |
9680116 |
T |
 |
| Q |
225 |
atctctgtatgcaaaaattggattccctttgc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9680117 |
atctctgtatgcaaaaattggattccctttgc |
9680148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 9679859 - 9679888
Alignment:
| Q |
1 |
gcagtcgataattcatgcagtcagccgatc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9679859 |
gcagtcgataattcatgcagtcagccgatc |
9679888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 109 - 262
Target Start/End: Complemental strand, 33546770 - 33546617
Alignment:
| Q |
109 |
atacctttcccatgttggataacaaaggtaggttataaccactgatttttgcaacaaagttctggtccaataaaacatcagtaattttgatattgtttga |
208 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||||||| || ||||||||||||| || || |||||||||| ||| |||||||||||||| || |
|
|
| T |
33546770 |
atacctttcctatgttagataacaaaggtagattataactgctaatttttgcaacaagattgtgatccaataaaatatcttctattttgatattgttgga |
33546671 |
T |
 |
| Q |
209 |
atatacaccaggaacaatctctgtatgcaaaaattggattccctttgcttctcc |
262 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
33546670 |
atatacaccagggacaattcctgtatgcaaaaattggattccctttgctactcc |
33546617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University