View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_37 (Length: 252)
Name: NF4778_low_37
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 23 - 231
Target Start/End: Original strand, 3338799 - 3339016
Alignment:
| Q |
23 |
cattacttttacaatattaactttat---------ttgtattaccattatcattaaccatcagaaagataagcacatgcttgtatgtccaattttctatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338799 |
cattacttttacaatattaactttatcaaagattgttgtattaccattatcattaaccattagaaagataagcacatgcttgtatgtccaattttctatt |
3338898 |
T |
 |
| Q |
114 |
gcattaaaaatcgataataagcgacaagtataatagaaagaaaaagtatcacacatctcacttatactagcgaaaaacagacatattagttttttgagag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3338899 |
gcattaaaaatcgataataagcgacaagtataatagaaagaaaaagtatcacacatctcacttatactagcgaaaaacagacatattagtttttttagag |
3338998 |
T |
 |
| Q |
214 |
aaaaacagacatattagt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3338999 |
aaaaacagacatattagt |
3339016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University