View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_47 (Length: 218)
Name: NF4778_low_47
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 10303547 - 10303748
Alignment:
| Q |
1 |
atgtttttgaaaagtgatatttttatttctcttattttgtcacttgattgactccctatctaattgatatcttgtgagaaattctcctacaatgggaaat |
100 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10303547 |
atgtttttgaaaagtggtgtttttatttctcttattttgtcacttgattgactccatatctaattgatatcttgtgagaaattctcctacaatgggaaat |
10303646 |
T |
 |
| Q |
101 |
agatgctgaccaaaatatttgcacatccattaagtgtaacaaattagtt-aagnnnnnnnnnnnnnagaataaaaattagtcaagatatttagaagaata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10303647 |
agatgctgaccaaaatatttgcacatccattaagtgtaacaaattacttcaagttttttattttttagaataaaaattagtcaagatatttagaagaata |
10303746 |
T |
 |
| Q |
200 |
tg |
201 |
Q |
| |
|
|| |
|
|
| T |
10303747 |
tg |
10303748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University