View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4778_low_48 (Length: 214)

Name: NF4778_low_48
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4778_low_48
NF4778_low_48
[»] chr7 (1 HSPs)
chr7 (18-196)||(37643170-37643348)
[»] chr3 (2 HSPs)
chr3 (47-119)||(44171171-44171243)
chr3 (47-119)||(44191467-44191539)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 37643348 - 37643170
Alignment:
18 aagaaatgaggtgatctgacttgactacatgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37643348 aagaaatgaggtgatctgacttgactacatgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagct 37643249  T
118 atagtcctacgccacttaaaataaaaattgataagagttttatatgtgaaagctgtcagctaggaaacaggtctggtat 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37643248 atagtcctacgccacttaaaataaaaattgataagagttttatatgtgaaagctgtcagctaggaaacaggtctggtat 37643170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 119
Target Start/End: Complemental strand, 44171243 - 44171171
Alignment:
47 tgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagctat 119  Q
    |||||||||||||||||||||||||| ||| ||| ||| |||| ||  |||| || |||||| ||||||||||    
44171243 tgttcttcgagtttgagttgcgaagaatatgtaacggctggtccgtgtgatttagtatgcaagtggaagctat 44171171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 119
Target Start/End: Complemental strand, 44191539 - 44191467
Alignment:
47 tgttcttcgagtttgagttgcgaagagtatataatggcaggtcagtcagattgagcatgcaaatggaagctat 119  Q
    |||||||||||||||||||||||||| ||| ||| ||| |||| ||  |||| || |||||| ||||||||||    
44191539 tgttcttcgagtttgagttgcgaagaatatgtaacggctggtccgtgtgatttagtatgcaagtggaagctat 44191467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University