View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4778_low_50 (Length: 208)
Name: NF4778_low_50
Description: NF4778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4778_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 20 - 118
Target Start/End: Complemental strand, 16780361 - 16780263
Alignment:
| Q |
20 |
agtaattggtcgaaactcttctaacatttcaagacccatcttcttggttagctatggcttgtattacaatgtagggaattctcttaaaatagaaccaac |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16780361 |
agtaattggtagaaactcttctaacatttcaagacccatcttcttggttagctatggcttgtattacaatgtaggaaattctcttaaaatagaaccaac |
16780263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 33795133 - 33795233
Alignment:
| Q |
20 |
agtaattggtcgaaactcttctaacatttcaagacccatcttcttggttagc--tatggcttgt-attacaatgtagggaattctcttaaaatagaacca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||| | || ||||| |||||||| ||||||||||||||| |
|
|
| T |
33795133 |
agtaattggtcgaaactcttctaacatttcaagacccattttcttagttagctatatggcttctaataacaatagagggaattaacttaaaatagaacca |
33795232 |
T |
 |
| Q |
117 |
a |
117 |
Q |
| |
|
| |
|
|
| T |
33795233 |
a |
33795233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University