View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780-Insertion-13 (Length: 466)
Name: NF4780-Insertion-13
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780-Insertion-13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 280 - 450
Target Start/End: Complemental strand, 7139363 - 7139193
Alignment:
| Q |
280 |
gtgattgaatataactacacgtgtagttttgatccggtgtttgaacccacaccgacatcaaacatgctttcaatctgaagtgttggtgctacatagtgaa |
379 |
Q |
| |
|
||||||||||||||||| | |||||| | |||||||| || ||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7139363 |
gtgattgaatataactatgcatgtagtgtcgatccggtcttagaaccgacacagacatcaaacatgctttcaatctgaagtgttagtgctacatagtgaa |
7139264 |
T |
|
| Q |
380 |
ggatgtgtgcgtgtgtcaatttattatgctgatggtacatattgacagatgacagatgtggttttcttttt |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
7139263 |
ggatgtgtgcgtgtgtcaatttattatgctgatggtacagattgatagatgacagatgtggttttcttttt |
7139193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 123 - 202
Target Start/End: Complemental strand, 7139981 - 7139902
Alignment:
| Q |
123 |
ggtggagcaatggcttctaaagaaggtgaattggcggatttatctggacttgtatctggtactttcaaggttagttttta |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| ||||| ||||| |||||| ||||||||||||||||||| |
|
|
| T |
7139981 |
ggtggagctatggcttctaaagaaggtggattggcggatttttctggtcttgtttctggtgctttcaaggttagttttta |
7139902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 333 - 372
Target Start/End: Original strand, 9175556 - 9175595
Alignment:
| Q |
333 |
gacatcaaacatgctttcaatctgaagtgttggtgctaca |
372 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
9175556 |
gacatcatacatgcattcaatctgaagtgttggtgctaca |
9175595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 376
Target Start/End: Original strand, 303755 - 303790
Alignment:
| Q |
341 |
acatgctttcaatctgaagtgttggtgctacatagt |
376 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
303755 |
acatgccttcaatctgaagtgttggtgctacatagt |
303790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 333 - 374
Target Start/End: Complemental strand, 2642883 - 2642842
Alignment:
| Q |
333 |
gacatcaaacatgctttcaatctgaagtgttggtgctacata |
374 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
2642883 |
gacatcaaacatgcattcaatatgaagtgctggtgctacata |
2642842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 377
Target Start/End: Complemental strand, 42252219 - 42252183
Alignment:
| Q |
341 |
acatgctttcaatctgaagtgttggtgctacatagtg |
377 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42252219 |
acatgccttcaatctgaagtgtcggtgctacatagtg |
42252183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University