View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780-Insertion-16 (Length: 379)
Name: NF4780-Insertion-16
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780-Insertion-16 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 267 - 379
Target Start/End: Original strand, 39299562 - 39299674
Alignment:
| Q |
267 |
cccacattgaacctacatttccagcaccaggtacttttccttcacctcttgttcctaaatcctctgtttttcttcctttctcggccacaacttgtcctgt |
366 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39299562 |
cccacatcgaacctacatttccagcaccaggtacttttccttcacctcttgttcctaaatcctctgtttttcttcctttctctgccacaacttgtcctgt |
39299661 |
T |
|
| Q |
367 |
tcccattcctctg |
379 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39299662 |
tcccattcctctg |
39299674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 68 - 176
Target Start/End: Original strand, 39299363 - 39299471
Alignment:
| Q |
68 |
tgttcagcaccactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgctcagctacactctttcccaagattacaccttcatttt |
167 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39299363 |
tgttcagcagcactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgctcagcaacactctttcccaagattacaccttcatttt |
39299462 |
T |
|
| Q |
168 |
caccaccaa |
176 |
Q |
| |
|
||||||||| |
|
|
| T |
39299463 |
caccaccaa |
39299471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 37
Target Start/End: Original strand, 39299303 - 39299332
Alignment:
| Q |
8 |
ctatacttccctatctcttccaaagacatt |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39299303 |
ctatacttccctatctcttccaaagacatt |
39299332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University