View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780-Insertion-18 (Length: 197)
Name: NF4780-Insertion-18
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780-Insertion-18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 197
Target Start/End: Complemental strand, 38454512 - 38454327
Alignment:
| Q |
8 |
catacgatggtttatattgattttggtttttattaattatctgcatatgtttcccatacttctctcttcccttgcttgttagaacttagaatcataatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38454512 |
catacgatggtttatattgattttggtttttattaattatctgcatatgtttcccatacttctctcttcccttgcttgttagaacttagaatcataatct |
38454413 |
T |
|
| Q |
108 |
agcatagtacgtaccattttgttttttatttcaaaaccacagcatgcatgcatgcatgtatgcatggttctgttatattcattcttagca |
197 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38454412 |
aggatagtacgtaccattttgttttttatttcaaaaccactgcatgcatg----catgtatgcatggttctgttatattcattcttagca |
38454327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 153
Target Start/End: Original strand, 44473959 - 44473989
Alignment:
| Q |
123 |
attttgttttttatttcaaaaccacagcatg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44473959 |
attttgttttttatttcaaaaccacagcatg |
44473989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University