View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780-Insertion-20 (Length: 104)
Name: NF4780-Insertion-20
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780-Insertion-20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 32046367 - 32046462
Alignment:
| Q |
7 |
agagattagagaataatccttttatatacatagtacaagtattttagcatgcatggttttcaccaacttttagtaaaggtcagaagagaataatccca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046367 |
agagattagagaataatccttttatataca--gtacaagtattttagcatgcatggttttcaccaacttttagtaaaggtcagaagagaataatccca |
32046462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University