View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780-Insertion-22 (Length: 60)
Name: NF4780-Insertion-22
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780-Insertion-22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 41452463 - 41452514
Alignment:
| Q |
6 |
cagtttcagcgtcttcttcatcactgatattctctctattttccacgtcatg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41452463 |
cagtttcagcgtcttcttcatcactgatattctctctattttccacgtcatg |
41452514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 27; Significance: 0.000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 27; E-Value: 0.000001
Query Start/End: Original strand, 7 - 33
Target Start/End: Complemental strand, 4058621 - 4058595
Alignment:
| Q |
7 |
agtttcagcgtcttcttcatcactgat |
33 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4058621 |
agtttcagcgtcttcttcatcactgat |
4058595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University