View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4780-Insertion-23 (Length: 78)

Name: NF4780-Insertion-23
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4780-Insertion-23
NF4780-Insertion-23
[»] chr6 (3 HSPs)
chr6 (7-68)||(12344597-12344658)
chr6 (18-70)||(12308873-12308925)
chr6 (18-72)||(35189169-35189224)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 4e-25; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 12344597 - 12344658
Alignment:
7 aattgttccttgaaatcaacctttctccaccttctgctatcttcaacttccacattttttct 68  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
12344597 aattgttccctgaaatcaacctttctccaccttctgctatcttcaacttccacattttttct 12344658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 12308873 - 12308925
Alignment:
18 gaaatcaacctttctccaccttctgctatcttcaacttccacattttttcttt 70  Q
    |||||||||||||||||||||||| ||||||||||||||||||| ||||||||    
12308873 gaaatcaacctttctccaccttctcctatcttcaacttccacatattttcttt 12308925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 35189169 - 35189224
Alignment:
18 gaaatcaacctttctccaccttctgctatcttcaacttccacat-tttttctttac 72  Q
    |||||||||| |||||| |||||||||||||||||||||||||| |||||||||||    
35189169 gaaatcaacccttctcctccttctgctatcttcaacttccacatctttttctttac 35189224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University