View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780-Insertion-23 (Length: 78)
Name: NF4780-Insertion-23
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780-Insertion-23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 4e-25; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 12344597 - 12344658
Alignment:
| Q |
7 |
aattgttccttgaaatcaacctttctccaccttctgctatcttcaacttccacattttttct |
68 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12344597 |
aattgttccctgaaatcaacctttctccaccttctgctatcttcaacttccacattttttct |
12344658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 12308873 - 12308925
Alignment:
| Q |
18 |
gaaatcaacctttctccaccttctgctatcttcaacttccacattttttcttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12308873 |
gaaatcaacctttctccaccttctcctatcttcaacttccacatattttcttt |
12308925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 35189169 - 35189224
Alignment:
| Q |
18 |
gaaatcaacctttctccaccttctgctatcttcaacttccacat-tttttctttac |
72 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35189169 |
gaaatcaacccttctcctccttctgctatcttcaacttccacatctttttctttac |
35189224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University