View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_22 (Length: 369)
Name: NF4780_high_22
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 24 - 365
Target Start/End: Original strand, 42800402 - 42800744
Alignment:
| Q |
24 |
ggtttgtcagaatcacggtgaaccaccatgattctgatatactatcgtgataccaaacatgcacataaattttcatctgggtgtgatcaaaatcacnnnn |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800402 |
ggtttgtcagaatcacggtgaaccaccatgattctgatatactatcgtgataccaaacatgcacataaattttcatctgggtgtgatcaaaatcactttt |
42800501 |
T |
 |
| Q |
124 |
nnnnn-attcaatcaaaatcagacacatacatacatagacactaaactaccttggtttttagcaggcaaaggaaaagcagaaacaggtatgctttcaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800502 |
tcttttattcaatcaaaatcagacacatacatacatagacactaaactaccttggtttttagcaggcaaaggaaaagcagaaacaggtatgctttcaaaa |
42800601 |
T |
 |
| Q |
223 |
caagcattaagtttgtcattaggacttaattgtgcctcttgaacatcccatagatcttcaactctcctcccaagtttggcttcagggctccttggcatct |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42800602 |
caagcattaagtttgtcattaggacttaattgtgcctcttgaacatcccatagatcttcaactctcatcccaagtttggcttcagggctccttggcatct |
42800701 |
T |
 |
| Q |
323 |
ctctcattgtagccattgccattattccctcttcttctctctc |
365 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
42800702 |
ctctcattgtagccattgccattactccctcttcttttctctc |
42800744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University