View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_24 (Length: 356)
Name: NF4780_high_24
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 356
Target Start/End: Original strand, 30498282 - 30498620
Alignment:
| Q |
19 |
gaaccgaactcggcccagccggtgccacagcctttcgatccttctgtctccggtgacagaaccacatctgcaattgacgatcagacaaacccaacttcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30498282 |
gaaccgaactcggcccagccggtgccacagcctttcgatccttctgtctccggtgacagaaccacatctgcaattgacgatcagacaaacccaacttcac |
30498381 |
T |
 |
| Q |
119 |
agctaactcacccctcgttgcctcagaagggtaagtctccactgaacaaccaaaaatacaaaaaacccatcacagaaaagctcatatttcagcacaaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30498382 |
agctaactcacccctcgttgcctcagaagggtaagtctccactgaacaaccaaaaatacaaaaaacccatcacacaaaagctcatatttcagcacaaaat |
30498481 |
T |
 |
| Q |
219 |
catactacagaccataacccaaaacaatgcacac-nnnnnnnnntgaaattttttcacttactagcataagttttttcaagaatctccaactgtgaagga |
317 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30498482 |
catactacaaaccataacccaaaacaatgcacacataaaaaaaatgaaattttttcacttactagcataagttttttcaagaatctccaactgtgaagga |
30498581 |
T |
 |
| Q |
318 |
gtcttctttttgcgcttcactctgttctcttcctccaat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30498582 |
gtcttctttttgcgcttcactctgttctcttcctccaat |
30498620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 262 - 324
Target Start/End: Complemental strand, 48671902 - 48671840
Alignment:
| Q |
262 |
tgaaattttttcacttactagcataagttttttcaagaatctccaactgtgaaggagtcttct |
324 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48671902 |
tgaatttttttcacttactagcataagctttttcaagaatctccaactgtgaaagagtcttct |
48671840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University