View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_47 (Length: 287)
Name: NF4780_high_47
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 22 - 283
Target Start/End: Complemental strand, 8043278 - 8043017
Alignment:
| Q |
22 |
gattcttctatgatgagtgtgagtgtaggggaacgtggtttaatgaggtagcggaaggtgttgtaaaggtagccacgaattggttgagggatgagttctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8043278 |
gattcttctatgatgagtgtgagtgtaggggaacgtggtttaatgaggtagcggaaggtgttgtaaaggtagccacgaattggttgagggatgagttctt |
8043179 |
T |
 |
| Q |
122 |
gtgccatggaacgaagcagcatgatggaagctgtcatggatgcataagctgagaaaattgtagatggtgaaggcatttctctttgagaaaacattatgtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8043178 |
gtgccatggaacgaagcagcatgatggaagctgtcatggatgcataagctgagaaaattgtagatggtgaaggcatttctctttgagaaaacattatgtt |
8043079 |
T |
 |
| Q |
222 |
tggtttgtcaagtgaagggagataattgtgttttgtaattttgattctatcctatgcttctc |
283 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8043078 |
tggtttctcaagtgaagggagataattgtgttttgtaattttgattctatcctatgtttctc |
8043017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University