View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_54 (Length: 257)
Name: NF4780_high_54
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 33216217 - 33216334
Alignment:
| Q |
122 |
ctattccatatattttgtttttaccataatctactattctaccatttttgtccttatgctttattttgttatatcacttacaatgatatgccattgctat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33216217 |
ctattccatatattttgtttttaccataatctactattctcccatttttgtccttatgctttattttgttataccacttacaatgatatgccattgctat |
33216316 |
T |
 |
| Q |
222 |
caatgtttaacagaagac |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33216317 |
caatgtttaacagaagac |
33216334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University