View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_78 (Length: 228)
Name: NF4780_high_78
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 15841940 - 15842162
Alignment:
| Q |
1 |
tatggggaagtaaatattataaggaaattccgttggtatccgttgtttttgttaggatattggtacccttaaataagtaggaacatgacaactcaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15841940 |
tatggggaagtaaatattataaggaaattccgttggtatccgttgtttttgttaggatattggtacccttaaataagtaggaacatgacaactcaattga |
15842039 |
T |
|
| Q |
101 |
aatttgaaacataaataccataaattatgaagcactttttactgcatacaacaacaataggtagtgtgcagtacataaatatatgcaagcaaatatttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842040 |
aatttgaaacataaataccataaattatgaagcactttttactgcatacaacaacaataggtagtgtgcagtacataaatatatgcaagcaaatatttta |
15842139 |
T |
|
| Q |
201 |
taacaaggttgccctttgcttct |
223 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
15842140 |
taacaaggttgccctttgtttct |
15842162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 11 - 92
Target Start/End: Original strand, 15827708 - 15827789
Alignment:
| Q |
11 |
taaatattataaggaaattccgttggtatccgttgtttttgttaggatattggtacccttaaataagtaggaacatgacaac |
92 |
Q |
| |
|
|||||||||| |||||||||| |||| ||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
15827708 |
taaatattatgaggaaattcctttggattcctttgtttttattaggatattggtacccttaaatgagtagaaacatgacaac |
15827789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 144 - 207
Target Start/End: Original strand, 15822128 - 15822191
Alignment:
| Q |
144 |
gcatacaacaacaataggtagtgtgcagtacataaatatatgcaagcaaatattttataacaag |
207 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
15822128 |
gcatacaactacaataagtagtgtacagtacataaatttatgaaagcaaatatttcataacaag |
15822191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University