View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_86 (Length: 203)
Name: NF4780_high_86
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_86 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 174
Target Start/End: Original strand, 3587015 - 3587171
Alignment:
| Q |
18 |
aggtataaggttcaattaattcgtgttagcagtcttatccttagccttataaagaacctgtattcggttgccaagagtttaaatacannnnnnnaattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
3587015 |
aggtataaggttcaattaattcgtgttagcagtcttatccttagccttataaagaacctgtattcggttgctaaaagtttaaatacatttttttaattaa |
3587114 |
T |
 |
| Q |
118 |
gttcgtacgtgagctcgctgaattgtgcacgagtatatggatttttactctggatta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3587115 |
gttcgtacgtgagctcgctgaattgtgcacgggtatgtggatttttactctggatta |
3587171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University