View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_high_88 (Length: 202)
Name: NF4780_high_88
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_high_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 13464204 - 13464359
Alignment:
| Q |
17 |
ttctctagtgtcgatttcctattgaaatcggtggcattatgctcttccacttggagttcagattatgtcatcccatattttctgcgaaggcaattgttgt |
116 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13464204 |
ttctctagtgtcgatctcctatcggaatcggtggcattatgctattcgacttggagttcagattatgtcatcccatattttatgcgaaggcaattgttgt |
13464303 |
T |
 |
| Q |
117 |
gcttatgagcttgtgaatatggggcacttggttcggggatcagtttcgttgaatga |
172 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13464304 |
gcttataagcttgcgaatatggggcacttggttcggggatcagtttcgttgaatga |
13464359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University