View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_10 (Length: 447)
Name: NF4780_low_10
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 221 - 437
Target Start/End: Complemental strand, 52853194 - 52852975
Alignment:
| Q |
221 |
ccaacttcaaaacacgaattggtgtgtgaagggaaaaacacc---taccttatcctgaaggactcaaggacaacgcaatgcccactttgaacctcttcac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853194 |
ccaacttcaaaacacgaattggtgtgtgaagggagaaacaccacctaccttatcctgaaggactcaaggacaacgcaatgcccactttgaacctcttcac |
52853095 |
T |
|
| Q |
318 |
caacatccccgtggatcctgttattgcttccgacattctcagggatgccaccaaagttgttgcaaaaatcatcggaaagcccgaatccgttgagtccaat |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853094 |
caacatccccgtggatcctgttattgcttccgacattctcagggatgccaccaaagttgttgcaaaaatcatcggaaagcccgaatccgttgagtccaat |
52852995 |
T |
|
| Q |
418 |
ttcttccttttcctcctttg |
437 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52852994 |
ttcttccttttcctcctttg |
52852975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 18 - 155
Target Start/End: Complemental strand, 52853402 - 52853260
Alignment:
| Q |
18 |
atgtcatggtaccaaactcgtttcaactatt---gccaagggctc---aacaataacagttggattgaaacattttattgtcaaactttttctttttgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853402 |
atgtcatggtaccaaactcgtttcaagtattattgccaagggctcctcaacaataacacttggattgaaacattttattgtcaaactttttctttttgtt |
52853303 |
T |
|
| Q |
112 |
gataaaaatgacaacttgttgcaatgtttagaaagttggggacc |
155 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52853302 |
gataaaaatgacaacttgttgcaatg-ttagaaagttggggacc |
52853260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 294 - 415
Target Start/End: Complemental strand, 52849071 - 52848950
Alignment:
| Q |
294 |
aatgcccactttgaacctcttcaccaacatccccgtggatcctgttattgcttccgacattctcagggatgccaccaaagttgttgcaaaaatcatcgga |
393 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| || |||||||||||||||||| ||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
52849071 |
aatgcctactttgaacctcttcaccaacgtccctgttgatcctgttattgcttccaacattctaagggatgccaccaaagcgattgcaaacatcatcgga |
52848972 |
T |
|
| Q |
394 |
aagcccgaatccgttgagtcca |
415 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
52848971 |
agacccgaatccgttgagtcca |
52848950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University