View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_16 (Length: 388)
Name: NF4780_low_16
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 215 - 375
Target Start/End: Original strand, 19026304 - 19026464
Alignment:
| Q |
215 |
ttttcatgttattggctttctatttctgctgagagctaattggttgaaatccataatttatagtgactgatctagatgaggatgtcttgcaaacattttt |
314 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||||||||||| ||||| |||| | |||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
19026304 |
ttttcatgtcattggcattccgtttctgctgagagctaattggttggaatccttaatgtttagtgagtgatgtagatgaggatgtcttgcaaacattttt |
19026403 |
T |
|
| Q |
315 |
gaaggatagagaattaaacggtgattttgtatcaagaacttgtgatttactatggcgaatg |
375 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19026404 |
gaaggatagagaattaaatggtgattttgtatcaagaacttgtgatttactatggcgaatg |
19026464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 75 - 200
Target Start/End: Original strand, 19025905 - 19026031
Alignment:
| Q |
75 |
tttatttttagtttaatatacctatatagaacataatagcttatgttaaaaa--gggcttatggtctaatggttaaagctcctcattttaattagaggag |
172 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||||||| |||| | ||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
19025905 |
tttatttttagtttagtatag-tatatagaatataatagcttatgttaaaaaaagggcatctggtctaatggctaaagctcctaattttaattagaggag |
19026003 |
T |
|
| Q |
173 |
tgctagctacacactttgtaggcttcat |
200 |
Q |
| |
|
||||||| | ||||| | |||||||||| |
|
|
| T |
19026004 |
tgctagcaagacactctataggcttcat |
19026031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University