View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_36 (Length: 319)
Name: NF4780_low_36
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 4 - 272
Target Start/End: Complemental strand, 28267781 - 28267513
Alignment:
| Q |
4 |
agatggacatcatcaattagtagaagtgctatgtcactgaaaaaactcaaaccaccgctttctataccatatcgcgacactgcatcaaatttctattcat |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267781 |
agatggacttcatcaattagtagaagtgctatgtcactgaaaaaactcaaaccaccgctttctataccatatcgcgacactgcatcaaatttctattcat |
28267682 |
T |
|
| Q |
104 |
tgaaaaatgaactttagccacctcatagtgtcaacaaatcagtcagtgtgtgtgtcagtctgacaggaaaaataaatgtttattgtgtctctttggattg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267681 |
tgaaaaatgaactttagccacctcatagtgtcaacaaatcagtcagtgtgtgtgtcagtctgacaggaaaaataaatgtttattgtgtctctttggattg |
28267582 |
T |
|
| Q |
204 |
aggaatacgtgcataaacatcataatttatgattactttgaaatctatgtccatttaatatttcaaagg |
272 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28267581 |
aggaatacatgcataaacatcataatttatgattgctttgaaatctatgtccatttaatatttcaaagg |
28267513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University