View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_38 (Length: 314)
Name: NF4780_low_38
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 15 - 297
Target Start/End: Complemental strand, 11111983 - 11111701
Alignment:
| Q |
15 |
aatagttagattagatgtgttcatgtgctgcattgtttcatttttcattcttgtgtttcagtttagatttttctcttttgtatagatatatggaaatttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11111983 |
aatagttagattagatgtgttcatgtgctgcattgtttcatttttcattcttgtgtttcagtttagatttttctcttttgtatagatatatggaaatttg |
11111884 |
T |
|
| Q |
115 |
ggatataggtctgtttgaatagagggatgggaaagagggcgacgacaaccctttggtggtggaaggtgaatggaagagaaatggcattgagaagtagaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11111883 |
ggatataggtctgtttgaatagagggatgggaaagagggcgacgacaaccctttggtggtggaaggtgaatggaagagaaatggcattgagaagtagaaa |
11111784 |
T |
|
| Q |
215 |
ggggcctttcagtaaataattttgttggttttaaatctagaccatatttataataagagttttaactagagaggcaatatgat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11111783 |
ggggcctttcagtaaataattttgttggttttaaatctagaccatatttataataagagttttaactagagaggcaatatgat |
11111701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University