View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_46 (Length: 292)
Name: NF4780_low_46
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 11 - 273
Target Start/End: Complemental strand, 41258338 - 41258077
Alignment:
| Q |
11 |
cagagaggtgcagtgaaatatatacagccactacttttaaagtacatcaaaccatttactttttgacatatataattaatcacagtaaaaaattgcacta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41258338 |
cagagaggtgcagtgaaatatatacagccactacttttaaagtacatcaaaccatttactttttgacatatataattaatcacagtaaaaaactgcacta |
41258239 |
T |
|
| Q |
111 |
ggtattactagcataaaagaaaaatcattgttactatacttgattttattgtgatgggatatttttgttcctattgaagagtaaaatgaaaggaaaagac |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41258238 |
ggtattactagcataaa-gaaaaatcattgttactatacttgattttattgtgatggaatatttttgttcctattgaagagtaaaatgaaaggaaaagac |
41258140 |
T |
|
| Q |
211 |
tacacatgcataataatattccaagaataaacgtaccttgatagtgaaggagttcaacatggt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41258139 |
tacacatgcataataatattccaagaataaacgtaccttgatagtgaaggagttcaacatggt |
41258077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University