View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_60 (Length: 252)
Name: NF4780_low_60
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 2265539 - 2265653
Alignment:
| Q |
1 |
gaaatcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattatttgttcttatctattaaccttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265539 |
gaaatcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattatttgttcttatctattaaccttaaa |
2265638 |
T |
|
| Q |
101 |
acgtcaaagcttctt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2265639 |
acgtcaaagcttctt |
2265653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 126 - 248
Target Start/End: Original strand, 2265691 - 2265813
Alignment:
| Q |
126 |
cgtcaaaggaatatagagaaattaaagtaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265691 |
cgtcaaaggaatatagagaaattaaaggaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
2265790 |
T |
|
| Q |
226 |
atgaactcccactctgtgctgct |
248 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
2265791 |
atgaactcccactcagtgctgct |
2265813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University