View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_65 (Length: 250)
Name: NF4780_low_65
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_65 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 34890610 - 34890385
Alignment:
| Q |
1 |
ccaaactataaagagtaggagtgaaaataaaacaagtcacgtatggggatctacaccttaacatatttaaaatatagtttcgtctagctcatttaataaa |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
34890610 |
ccaagctataaagagtaggagtg-----taaacaagtcaggtatggggatttacaccttaacatatttaaaatatagtttggtccagctcatctaataaa |
34890516 |
T |
 |
| Q |
101 |
aaggttaaactcatactttttatgaagcgtatttaaccaaatagacgacaaaggattttactagannnnnnnngttgagaggtgtactagaatttgatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34890515 |
aaggttaaactcatactttttatgaagcgtatttaaccaaatagacga-taaggattttactagattttttttgttgagaggtgtactagaatttgatac |
34890417 |
T |
 |
| Q |
201 |
cctccaaattgaattacattaaatgaattgta |
232 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| |
|
|
| T |
34890416 |
cctccaaattgaattacattcaatggattgta |
34890385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University