View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_67 (Length: 249)
Name: NF4780_low_67
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 43164940 - 43164701
Alignment:
| Q |
8 |
ataatactagtagacaatcattcttctcttgtgaaaaagttgcttgtctttagtgaaatggaactatagatgaggaaaatggcagcttaagacgtgatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43164940 |
ataatactagtagacaatcattcttctcttgtgaaaaagttgcttgtcttttgtgaaatggaactatagatgaggaaaatggtagcttaagacgtgatat |
43164841 |
T |
 |
| Q |
108 |
attgttacatgtatcatgaaagaataaagtgctcatatgtgcaggcgttgaccttagttgtaaacaaaaataaatgacattttattcatgtttcacacat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43164840 |
attgttacatgtatcatgaaagaataaagtgctcatatgtgcaggcgttgaccttagttgtaaacaaaaataaatgacattttatttatgtttcacacat |
43164741 |
T |
 |
| Q |
208 |
tcacatttcgataattaatcacaaaatgtagaaaatacac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164740 |
tcacatttcgataattaatcacaaaatgtagaaaatacac |
43164701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University