View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_70 (Length: 245)
Name: NF4780_low_70
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 238
Target Start/End: Original strand, 29704831 - 29705048
Alignment:
| Q |
21 |
tacactgagtttgtggtttctgagaagataaagggagaacccgtttgctcagctcagtcagaaatcaaggagattgagtgtggtactggcaatcctactg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29704831 |
tacactgagtttgtggtttctgagaagataaagggggaacccgtttgctcagctcattcagaaatcaaggagattgagtgtggtactggcaatcctactg |
29704930 |
T |
|
| Q |
121 |
tgatgaaagaaaactcgaaaaccatcgatgttaagactgctagtttgcgggttctcaagaagttggtgaggaagaagttagaagaaaaaacaaacatgat |
220 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29704931 |
tgatgaaagaaaactcgaaaaccatcaatgttaagactgctagtttgcgggttctcaagaagttggtgaggaagaagttagaagaaaaaacaaacatggt |
29705030 |
T |
|
| Q |
221 |
taataatgatgatgtcca |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29705031 |
taataatgatgatgtcca |
29705048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University