View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_81 (Length: 233)
Name: NF4780_low_81
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_81 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 37240538 - 37240320
Alignment:
| Q |
13 |
ataagagcaacaactatagatctcatgcttgggcgtagtagcggattgtctctcgtacatgctctcccaagttgagccatctgcaattcaaatattcaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37240538 |
ataagagcaacaactatagatctcatgcttgggcgtagtagcggattgtctctcgtacatgctctcccaagttgagccatctgcaattcaaatattcaca |
37240439 |
T |
|
| Q |
113 |
tatcttaagttatgttcaatgacaaaatctagtgctaaaacaaatgagtttagtaactttacaaactatacacttttgcatacatttttaattatatttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37240438 |
tatcttaagttatgttcaatgacaaaatctagtgctaaaacaaatgagtttagtaactttacaaactatacacttttgcataca--tttaattatatttt |
37240341 |
T |
|
| Q |
213 |
aataacatgaactttgcttat |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37240340 |
aataacatgaactttgcttat |
37240320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 125
Target Start/End: Complemental strand, 37316712 - 37316601
Alignment:
| Q |
13 |
ataagagcaacaactatagatctcatgcttgggcgtagtagcggattgtctctcgtacatgctctcccaagttgagccatctgcaattcaaatattcaca |
112 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |||||||| ||||||||| | |||||| |||| |||||||| ||||||| ||||||||| |||||| |
|
|
| T |
37316712 |
ataagagaaacaactatagatctcatacttggacgtagtagtggattgtcttttgtacattctcttccaagttgtgccatctacaattcaaacattcac- |
37316614 |
T |
|
| Q |
113 |
tatcttaagttat |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37316613 |
catcttaagttat |
37316601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University