View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_85 (Length: 228)
Name: NF4780_low_85
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_85 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 9784476 - 9784254
Alignment:
| Q |
6 |
aaatccctctttggacaataactttgtcttttaatatctcccttcccacaaattcttttagaatgtcaagacttgttgctagtaatttggtctatagatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9784476 |
aaatccctctttggacaataactttgtcttttaatatctcccttcccacaaattcttttagaatgtcaagacttgttgctagcaatttggtctatagatt |
9784377 |
T |
 |
| Q |
106 |
atgctcaataatctgtatggattatgctttgtccacaaatgaactttgtaagtttgaatgtattatacttgactagatcagtggtccacttaaatagttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9784376 |
atgctcaataatctgtatggattatgctttgtccacaaatgaactttgtaagtttgaatgtattatacttgactagatcagtggtcgacttaaatagttt |
9784277 |
T |
 |
| Q |
206 |
aggaaagaatgtcggcgttggta |
228 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
9784276 |
aggaaagaatgtcagcgttggta |
9784254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 98
Target Start/End: Complemental strand, 30036223 - 30036169
Alignment:
| Q |
44 |
tcccttcccacaaattcttttagaatgtcaagacttgttgctagtaatttggtct |
98 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
30036223 |
tcccttcccacaaattcttttagaatgcaaagacttgttgctggtaatttggtct |
30036169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 98
Target Start/End: Complemental strand, 30151959 - 30151905
Alignment:
| Q |
44 |
tcccttcccacaaattcttttagaatgtcaagacttgttgctagtaatttggtct |
98 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
30151959 |
tcccttcccacaaattcttttagaatgcaaagacttgttgctggtaatttggtct |
30151905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 163
Target Start/End: Complemental strand, 30036126 - 30036068
Alignment:
| Q |
105 |
tatgctcaataatctgtatggattatgctttgtccacaaatgaactttgtaagtttgaa |
163 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
30036126 |
tatgctcaataatttgtattgattatgctttgtctgcaaatgaactttgttagtttgaa |
30036068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 163
Target Start/End: Complemental strand, 30151862 - 30151804
Alignment:
| Q |
105 |
tatgctcaataatctgtatggattatgctttgtccacaaatgaactttgtaagtttgaa |
163 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
30151862 |
tatgctcaataatttgtattgattatgctttgtctgcaaatgaactttgttagtttgaa |
30151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 169
Target Start/End: Original strand, 34229151 - 34229216
Alignment:
| Q |
105 |
tatgctcaataatctgtatggattatgctttgtccacaaatg-aactttgtaagtttgaatgtatt |
169 |
Q |
| |
|
||||||||||||| || ||||||| || | |||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
34229151 |
tatgctcaataatttgaatggattctggtctgtccagaaatgaaactttgttagtttgaatgtatt |
34229216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University