View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_87 (Length: 219)
Name: NF4780_low_87
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 9214035 - 9213831
Alignment:
| Q |
1 |
tgaagttattgttgtaagtgcatgagattatgcatgttattttcaagtactccaacttaattcatctgccaatgtaaattaatgttgttgtttttgcagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
9214035 |
tgaagttattgttgtaagtgcatgagattatgtatgttattttcaagtactccaacttaattcatctgctaatgtaaattaatgttattgtttttgcagg |
9213936 |
T |
|
| Q |
101 |
gttgtcagcttgggaaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacagtgcaatagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
9213935 |
gttgtcagcttgggaaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacattgcagtagttg |
9213836 |
T |
|
| Q |
201 |
attgc |
205 |
Q |
| |
|
||||| |
|
|
| T |
9213835 |
attgc |
9213831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University